other:Article Title: BCL11A-deficient human erythropoiesis is impaired in vitro and after xenotransplantation into mice
Article Snippet: CD34 + HSPCs were incubated for 7 days in phase 1 medium (IMDM, Thermo Fisher Scientific, Waltham, MA), 3% human AB serum (Atlanta Biologicals, Flowery Branch, GA, S40110 ), 2% human blood type AB plasma (SeraCare, Milford, MA), 1× penicillin/streptomycin, 3 U/mL erythropoietin (EPOGEN; Amgen, Thousand Oaks, CA, # 55513-144-01), 3 U/mL heparin (Sagent Pharmaceuticals, Schaumburg, IL, 25021-401-02), 200 μg/mL holo-transferrin (Millipore Sigma, Burlington, MA, T0665), 10 ng/mL human stem cell factor, and 1 ng/mL human interleukin-3 (IL-3; R&D Systems, Minneapolis, MN, 203-IL/CF).
Article Title: Arctigenin Attenuates Hepatic Stellate Cell Activation via Endoplasmic Reticulum-Associated Degradation (ERAD)-Mediated Restoration of Lipid Homeostasis.
Article Snippet: Freshly isolated HSCs were cultured in Iscove’s Modified Dulbecco’s Medium (IMDM; Thermo Fisher Scientific, Breda, The Netherlands) supplemented with 20% fetal bovine serum, 1% MEM nonessential amino acids, 1% sodium pyruvate (all from Thermo Fisher Scientific), and antibiotics: 50 μg/ mL gentamycin (Thermo Fisher Scientific), 100 units/mL streptomycin (Lonza, Vervier, Belgium), 100 units/mL penicillin (Lonza), and 250 ng/Ml Fungizone (Lonza).
Article Title: An organ-chip model of sporadic ALS using iPSC-derived spinal cord motor neurons and an integrated blood-brain-like barrier.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LDN193189 Cayman Chemicals Cat#17502048 SB431542 Cayman Chemicals Cat#13031 CHIR99021 Cayman Chemicals Cat#13122 All-Trans Retinoic Acid (ATRA) Stemgent Cat#04-0021 Smoothened agonist (SAG) Cayman Chemicals Cat#11914 Y-27632 (ROCKi) StemCell Technologies Cat#72308 Dibutyryl-cAMP (db-cAMP) Millipore-Sigma Cat#28745 Recombinant Human FGF-basic Peprotech Cat#100-18B L-Ascorbic acid Sigma-Aldrich Cat#A4403 Brain-derived neurotrophic factor (BDNF) PeproTech Cat#450-02 Glial-derived neurotrophic factor (GDNF) PeproTech Cat#450-10 Collagen Sigma-Aldrich Cat #C5533 Fibronectin Sigma-Aldrich Cat # F1141 Accutase Sigma-Aldrich Cat#SCR005 Matrigel® Growth Factor Reduced (GFR) Corning Cat#354230 Protector RNAse Inhibitor Millipore-Sigma Cat#3335402001 cOmpleteTM Protease Inhibitor Cocktail Millipore-Sigma Cat#11697498001 OptiPrepTM Density Gradient Medium Millipore-Sigma Cat#D1556 CellMaxxTM Bovine Albumin, Low Endotoxin Fisher Scientific Cat#MP219989610 Trypsin/Lys-C Mix, Mass Spec Grade Promega Cat#V5071 Critical commercial assays MycoAlert® Mycoplasma Detection Kit Lonza Cat#LT07-118 Pierce BCA Protein Assay kit Thermo Fisher Scientific Cat#23225 and 23227 CyQUANTTM LDH Cytotoxicity Assay Thermo Fisher Scientific Cat#C20301 Deposited data Bulk RNAseq raw data This paper GEO: GSE255602 Bulk Proteomics data This paper MassIVE: MSV000094871 snRNAseq raw data This paper GEO: GSE255605 Tables S1–S11 This paper Mendeley Data https://doi.org/ 10.17632/c3jhd93cww.1 Software and algorithms R Project for Statistical Computing (version 4.3.0) CRAN RRID: SCR_001905 tidyverse (version 2.0.0) CRAN RRID: SCR_019186 RColorBrewer (version 1.1.3) CRAN RRID: SCR_016697 EnrichR (version 3.2) CRAN RRID: SCR_001575 patchwork (version1.1.2) CRAN RRID: SCR_024826 circlize (version 0.4.15) CRAN RRID: SCR_002141 pheatmap (version 1.0.12) CRAN RRID: SCR_016418 ggrastr (version 1.0.2) CRAN RRID: SCR_024825 corrplot (version 0.92) CRAN RRID: SCR_024683 ComplexHeatmap (version 2.16.0) Bioconductor RRID: SCR_002141 DESeq2 (version 1.34.0) Bioconductor RRID: SCR_015687 biomaRt (version 2.50.0) Bioconductor RRID: SCR_019214 PCAtools (version 2.6.0) Bioconductor RRID: SCR_025593 EnhancedVolcano (version 1.12.0) Bioconductor RRID: SCR_018931 limma (version 3.50.0) Bioconductor RRID: SCR_010943 speckle (version 1.0.0) Bioconductor N/A Seurat (version 5.0.1) Satijalab.org RRID: SCR_016341 SeuratWrappers (version 0.3.2) Github RRID: SCR_022555 (Continued on next page) Cell Stem Cell 32, 1–15.e1–e7, July 3, 2025 e2
Recombinant:Article Title: An alternate receptor for adeno-associated viruses.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-GAPDH Abcam Cat# ab8245; RRID: AB_2107448 Mouse monoclonal anti-HA Biolegend Cat# 901501; RRID: AB_2565006 Mouse monoclonal anti-HA (HRP conjugate) Cell Signaling Technology Cat# 2999; RRID: AB_1264166 Mouse polyclonal anti-AAVR Abcam Cat# ab105385; RRID: AB_10712369 Rabbit monoclonal anti-AAVR2 Abcam Cat# ab184960 Donkey anti-mouse IgG, HRP conjugate Merck Cat# AP192P; RRID: AB_11213904 Donkey anti-rabbit IgG, HRP conjugate Merck Cat# AP182P; RRID: AB_92591 Mouse anti-His antibody TransGen Biotech Cat# HT501-01; RRID: AB_2801417 Chemicals, peptides, and recombinant proteins Blasticidin AG Scientific Cat# B-1247 Puromycin Gibco Cat# A1113803 Hygromycin B Roche Cat# 10843555001 BsmBI NEB Cat# R0580 DMEM Gibco Cat# 11965175 IMDM Gibco Cat# 12440053 Foetal Bovine Serum Bovogene Cat# SFBS TRIzol Invitrogen Cat# 15596026 Pierce ECL Western Blotting Substrate Thermo Fisher Scientific Cat# 32209 Lipofectamine 3000 Thermo Fisher Scientific Cat# L3000001 Polybrene Sigma Cat# TR-1003 EDTA-free protease inhibitor cocktail (cOmplete) Merck Cat# 4693132001 Polyethylenimine Polysciences Cat# 24765 Isopropyl β-D-1-thiogalactopyranoside (IPTG) Sigma Cat# I6758 One-Step Ultra TMB-ELISA substrate Thermo Fisher Scientific Cat# 34028 DAPI Invitrogen D1306 Experimental models: Cell lines HEK293T ATCC CRL-3216 Hepa1-6 ATCC CRL-1830 HeLa ATCC CRM-CCL-2 COS-7 ATCC CRL-1651 HuH7 CellBank Australia 01042712 .. eHAP Horizon Discovery C669 Experimental models: Organisms/strains Mouse: C57Bl/6J Australian BioResources N/A Mouse: C57Bl/6J Aavr2 knockout This paper N/A Oligonucleotides sgRNA for AAVR knockout: CTTTTGCTTCAGCGTTCTG Pillay et al. 14 N/A sgRNA for AAVR2 knockout in human cell lines and COS-7: CCGGGCGGCTCACATCAAGA This paper N/A sgRNA for AAVR2 knockout in Hepa1-6: AGCGGCCGTGACAACAGCCG This paper N/A scrambled sgRNA: GATTGTATGAACGCAATAGC This paper N/A (Continued on next page) ll OPEN ACCESS Cell 188, 1–12.e1–e7, September 4, 2025 e1 Please cite this article in press as: Dhungel et al., An alternate receptor for adeno-associated viruses, Cell (2025), https://doi.org/10.1016/j. cell.2025.06.026 Article
Western Blot:Article Title: An alternate receptor for adeno-associated viruses.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-GAPDH Abcam Cat# ab8245; RRID: AB_2107448 Mouse monoclonal anti-HA Biolegend Cat# 901501; RRID: AB_2565006 Mouse monoclonal anti-HA (HRP conjugate) Cell Signaling Technology Cat# 2999; RRID: AB_1264166 Mouse polyclonal anti-AAVR Abcam Cat# ab105385; RRID: AB_10712369 Rabbit monoclonal anti-AAVR2 Abcam Cat# ab184960 Donkey anti-mouse IgG, HRP conjugate Merck Cat# AP192P; RRID: AB_11213904 Donkey anti-rabbit IgG, HRP conjugate Merck Cat# AP182P; RRID: AB_92591 Mouse anti-His antibody TransGen Biotech Cat# HT501-01; RRID: AB_2801417 Chemicals, peptides, and recombinant proteins Blasticidin AG Scientific Cat# B-1247 Puromycin Gibco Cat# A1113803 Hygromycin B Roche Cat# 10843555001 BsmBI NEB Cat# R0580 DMEM Gibco Cat# 11965175 IMDM Gibco Cat# 12440053 Foetal Bovine Serum Bovogene Cat# SFBS TRIzol Invitrogen Cat# 15596026 Pierce ECL Western Blotting Substrate Thermo Fisher Scientific Cat# 32209 Lipofectamine 3000 Thermo Fisher Scientific Cat# L3000001 Polybrene Sigma Cat# TR-1003 EDTA-free protease inhibitor cocktail (cOmplete) Merck Cat# 4693132001 Polyethylenimine Polysciences Cat# 24765 Isopropyl β-D-1-thiogalactopyranoside (IPTG) Sigma Cat# I6758 One-Step Ultra TMB-ELISA substrate Thermo Fisher Scientific Cat# 34028 DAPI Invitrogen D1306 Experimental models: Cell lines HEK293T ATCC CRL-3216 Hepa1-6 ATCC CRL-1830 HeLa ATCC CRM-CCL-2 COS-7 ATCC CRL-1651 HuH7 CellBank Australia 01042712 .. eHAP Horizon Discovery C669 Experimental models: Organisms/strains Mouse: C57Bl/6J Australian BioResources N/A Mouse: C57Bl/6J Aavr2 knockout This paper N/A Oligonucleotides sgRNA for AAVR knockout: CTTTTGCTTCAGCGTTCTG Pillay et al. 14 N/A sgRNA for AAVR2 knockout in human cell lines and COS-7: CCGGGCGGCTCACATCAAGA This paper N/A sgRNA for AAVR2 knockout in Hepa1-6: AGCGGCCGTGACAACAGCCG This paper N/A scrambled sgRNA: GATTGTATGAACGCAATAGC This paper N/A (Continued on next page) ll OPEN ACCESS Cell 188, 1–12.e1–e7, September 4, 2025 e1 Please cite this article in press as: Dhungel et al., An alternate receptor for adeno-associated viruses, Cell (2025), https://doi.org/10.1016/j. cell.2025.06.026 Article
Protease Inhibitor:Article Title: An alternate receptor for adeno-associated viruses.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-GAPDH Abcam Cat# ab8245; RRID: AB_2107448 Mouse monoclonal anti-HA Biolegend Cat# 901501; RRID: AB_2565006 Mouse monoclonal anti-HA (HRP conjugate) Cell Signaling Technology Cat# 2999; RRID: AB_1264166 Mouse polyclonal anti-AAVR Abcam Cat# ab105385; RRID: AB_10712369 Rabbit monoclonal anti-AAVR2 Abcam Cat# ab184960 Donkey anti-mouse IgG, HRP conjugate Merck Cat# AP192P; RRID: AB_11213904 Donkey anti-rabbit IgG, HRP conjugate Merck Cat# AP182P; RRID: AB_92591 Mouse anti-His antibody TransGen Biotech Cat# HT501-01; RRID: AB_2801417 Chemicals, peptides, and recombinant proteins Blasticidin AG Scientific Cat# B-1247 Puromycin Gibco Cat# A1113803 Hygromycin B Roche Cat# 10843555001 BsmBI NEB Cat# R0580 DMEM Gibco Cat# 11965175 IMDM Gibco Cat# 12440053 Foetal Bovine Serum Bovogene Cat# SFBS TRIzol Invitrogen Cat# 15596026 Pierce ECL Western Blotting Substrate Thermo Fisher Scientific Cat# 32209 Lipofectamine 3000 Thermo Fisher Scientific Cat# L3000001 Polybrene Sigma Cat# TR-1003 EDTA-free protease inhibitor cocktail (cOmplete) Merck Cat# 4693132001 Polyethylenimine Polysciences Cat# 24765 Isopropyl β-D-1-thiogalactopyranoside (IPTG) Sigma Cat# I6758 One-Step Ultra TMB-ELISA substrate Thermo Fisher Scientific Cat# 34028 DAPI Invitrogen D1306 Experimental models: Cell lines HEK293T ATCC CRL-3216 Hepa1-6 ATCC CRL-1830 HeLa ATCC CRM-CCL-2 COS-7 ATCC CRL-1651 HuH7 CellBank Australia 01042712 .. eHAP Horizon Discovery C669 Experimental models: Organisms/strains Mouse: C57Bl/6J Australian BioResources N/A Mouse: C57Bl/6J Aavr2 knockout This paper N/A Oligonucleotides sgRNA for AAVR knockout: CTTTTGCTTCAGCGTTCTG Pillay et al. 14 N/A sgRNA for AAVR2 knockout in human cell lines and COS-7: CCGGGCGGCTCACATCAAGA This paper N/A sgRNA for AAVR2 knockout in Hepa1-6: AGCGGCCGTGACAACAGCCG This paper N/A scrambled sgRNA: GATTGTATGAACGCAATAGC This paper N/A (Continued on next page) ll OPEN ACCESS Cell 188, 1–12.e1–e7, September 4, 2025 e1 Please cite this article in press as: Dhungel et al., An alternate receptor for adeno-associated viruses, Cell (2025), https://doi.org/10.1016/j. cell.2025.06.026 Article
Fluorescence:Article Title: Human autoimmunity at single cell resolution in aplastic anemia before and after effective immunotherapy
Article Snippet: .. BMMNCs were resuspended in the IMDM (Cat# 12440053, Thermo Fisher Scientific) + 2% fetal bovine serum (Cat# 12306C, Sigma-Aldrich) before fluorescence-activated cell sorting (FACS) to enrich lineage − CD34 + HSPCs. .. BMMNCs were stained in 50 μl volume with monoclonal antibodies for 30 min on ice: 5 μl anti-human lineage cocktail (CD3, CD14, CD16, CD19, CD20 and CD56; clones UCHT1, HCD14, 3G8, HIB19, 2H7, and HCD56, respectively, Cat# 348805, Biolegend) in Pacific Blue; 5 μl anti-CD34 Ab (clone 581, Cat# 555822, BD Biosciences) in PE and 5 μl anti-CD38Ab (clone HIT2, Cat# 555462, BD Biosciences) in APC.
FACS:Article Title: Human autoimmunity at single cell resolution in aplastic anemia before and after effective immunotherapy
Article Snippet: .. BMMNCs were resuspended in the IMDM (Cat# 12440053, Thermo Fisher Scientific) + 2% fetal bovine serum (Cat# 12306C, Sigma-Aldrich) before fluorescence-activated cell sorting (FACS) to enrich lineage − CD34 + HSPCs. .. BMMNCs were stained in 50 μl volume with monoclonal antibodies for 30 min on ice: 5 μl anti-human lineage cocktail (CD3, CD14, CD16, CD19, CD20 and CD56; clones UCHT1, HCD14, 3G8, HIB19, 2H7, and HCD56, respectively, Cat# 348805, Biolegend) in Pacific Blue; 5 μl anti-CD34 Ab (clone 581, Cat# 555822, BD Biosciences) in PE and 5 μl anti-CD38Ab (clone HIT2, Cat# 555462, BD Biosciences) in APC.
Cell Culture:Article Title: Envelope protein-specific B cell receptors direct lentiviral vector tropism invivo
Article Snippet: .. Ramos, Raji, Daudi, Sp2/0, P3X63, Y3-Ag 1.2.3, HEK293T, and HEK293T-related cells were cultured in IMDM (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS) (Cytiva, Marlborough, MA, USA) and 1 pen/strep. .. CD79 HEK293T and CD79 Sp2/0 cells were generated by co-transduction of HEK293T cells with lentiviral vectors expressing human CD79A with a hygromycin-resistant gene and human CD79B with a puromycin-resistant gene, followed by culture in the presence of hygromycin (800 mg/mL, Thermo Fisher Scientific) and puromycin (2 mg/mL, Thermo Fisher Scientific).
Concentration Assay:Article Title: MEK-inhibitor for the treatment of viral and bacterial infections
Article Snippet: WST-Assay A549 cells were seeded in a 96-well flat-bottom tissue plate (Greiner, Germany) and were grown overnight. .. Thereafter, cells were treated with different concentrations of PD-0184264 (100 μM, 50 μM, 10 μM, 5 μM, 1 μM, 0.5 μM and 0.1 μM) dissolved in 100 μl IMDM (ThermoFisher, Germany) supplemented with 5% fetal calf serum (Sigma-Aldrich; Germany) final DMSO concentration=1% and cultivation was performed at 37° C. and 5% CO2 for 24 h. Thereafter, 10 μl WST-1 reagent (Roche, Germany) was added to the culture medium and incubated for four hours. ..
Incubation:Article Title: MEK-inhibitor for the treatment of viral and bacterial infections
Article Snippet: WST-Assay A549 cells were seeded in a 96-well flat-bottom tissue plate (Greiner, Germany) and were grown overnight. .. Thereafter, cells were treated with different concentrations of PD-0184264 (100 μM, 50 μM, 10 μM, 5 μM, 1 μM, 0.5 μM and 0.1 μM) dissolved in 100 μl IMDM (ThermoFisher, Germany) supplemented with 5% fetal calf serum (Sigma-Aldrich; Germany) final DMSO concentration=1% and cultivation was performed at 37° C. and 5% CO2 for 24 h. Thereafter, 10 μl WST-1 reagent (Roche, Germany) was added to the culture medium and incubated for four hours. ..
|
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 